what is sericulture answer Can Dogs Eat Salmon, Chile Twitter Meaning, Wella Thermal Image Spray, Largehead Hairtail Habitat, Is Ancova A Parametric Test, Tokyo Train Station, Landscape Architecture Master's Programs, 76 Keyboard Case, " /> Can Dogs Eat Salmon, Chile Twitter Meaning, Wella Thermal Image Spray, Largehead Hairtail Habitat, Is Ancova A Parametric Test, Tokyo Train Station, Landscape Architecture Master's Programs, 76 Keyboard Case, " /> Skip to Content

what is sericulture answer

Answer: It is a type of farming in which farmers clear a patch of land and produce cereals and other food crops to sustain their families. These eggs hatch into caterpillar or larvae. It is the rearing of silkworms to obtain silk. These are two types of silk worm reared in Nepal, i.e. General Knowledge Questions and Answers about Agriculture 1. Define sericulture. Wiki User Answered . No comments: Post a Comment. When the soil fertility decreases, the farmers shift and clear a fresh patch of land for cultivation. It is a very old occupation in India. The center of weaving and sericulture (silk worn production) for centuries 1 See answer xmariannalangx xmariannalangx Answer: golden thread silk is born in vietnam. ANSWER. Wiki User Answered . Hence sericulture or silk production is dependent on moriculture. The Chinese people knew the methods of cultivating silk and preparing cloth from it for more than 2000 years. Top Answer. What is sorting? the production of silk and the rearing of silk worms, This site is using cookies under cookie policy. • Sericulture, or silk farming, is the rearing of silkworms for the production of raw silk. You may refer to the answer provided by your friends @Others..Good work..keep posting! Silkworms are used to produce silk. Answer: (d) All of the above Growing vegetables, flowers and fruits for commercial use is known as horticulture. Answer. 2 ; … Answer: Sorting is the process of separating the different textures of hair. These eggs are stored over a clean paper or piece of cloth. Find answers to questions asked by student like you. What is sericulture? Sericulture is the cultivation of silk worms on a large scale for the production of silk. Show more Q&A. Labels: General Knowledge. Answer: (c) Sericulture Commercial rearing of silkworms is called sericulture. * See Answer *Response times vary by subject and question complexity. Sericulture is also known as silk farming. Other types of silkworms (such as Eri, Muga, and Tasar) are also cultivated for the production of ‘wild silks’. 6) The silk solidifies when it comes in contact with air. Fibre to Fabric Class 6 Extra Questions Short Answer Type. As Sericulture is a cottage industry, it offers exceptional career options to the women of rural India. Question 7. Determine whether this is a correctly Which country is the leading producer of wool? Sericulture is a process of rearing of silkworm to obtain silk. Answer: Sericulture is the production of silk and the rearing of silkworms for this purpose. Are you attend the AP Village Sericulture Assistant 2020 Computer based CBT Examination then get you marks and Solved Papers for PDF in Free Download with our page. The eggs of the silkworm moth hatch out within 10 days into creamy white rapidly moving caterpillars. Answered By . Historically sericulture was introduced in china by hoshomin, the queen of china. answered by Lifeeasy Authors. Bachelor of Hospital Administration (BHA), Business System & Infrastructure Management, Indian National Mathematical Olympiad (INMO). Newer Post Older Post Home. Rearing of silkworm to produce raw silk is called sericulture. Download PDF's. What process is occurring at the arrow(s) Moreover half of its practice is biology ie plantation of food plants for the worms and taking care of the worms is entomology and the remainig … 7. 2) The silk moth eggs hatch to form larvae or caterpillar known as silkworms .3) The larvae feeds on mulberry leaves. What is called reeling the silk? It is also known as shifting cultivation. 1 ; MULBERY CULTIVATION. your answer. Paragraph on Sericulture! Tagged in. It involves low levels of technology and household labour to produce a small output. This process is called shearing. Answer. It is a very old occupation in India. What is ‘slash and burn’ agriculture known as in the north-eastern region of India? MEDIUM. 9) The silk filaments are then wound on a reel . Sericulture, or silk farming, is the cultivation of silkworms to produce silk.Although there are several commercial species of silkworms, Bombyx mori (the caterpillar of the domestic silkmoth) is the most widely used and intensively studied silkworm. SERICULTURE or silk farming is the rearing of silkworms for the production of raw silk. Explain why this is true or false. Want to see this answer and more? 8) The silk is obtained by brushing the undamaged coccon to find the outside end of the filament. The rearing of silkworms for obtaining silk is called sericulture. Related Biology Q&A. Historically sericulture was introduced in china by hoshomin, the queen of china. Answer: (b) Mexico. b. 4)Having grown and molted several times silkworm weaves a net to hold itself. The production of silk generally involves two processes: The silkworm caterpillar builds its cocoon by producing and surrounding itself with a long, Answer: It is known as Jhumming’ in the north-eastern region of India. Question 8. Answer: When the cocoons are kept under the sun or boiled or exposed to steam, the silk fibres separate out. Sericulture. Sericulture is not very popular with people working for animal protection because sericulture involves killing of larvae for obtaining silk . Which are the important plantation crops in India? 0 votes . 2014: Cool online Exam AtoZ General Knowledge Questions and Answers. The rearing of silkworms for the production of raw silk is known as sericulture. Top Answer. Sericulture is the process of raising silkworms for their silk. The stages of silk production are as follows. 1)The silk moth lays thousands of eggs . II. Why do we need clothes? The sericulture is an important cottage industry, but is now the basis of large industries in China, Japan, India and some European countries, where the silkworm, Bombyx mori is reared on mulberry leaves on a mass scale to get raw silk from the cocoons of the caterpillars of the moth. Get copy of last few answers in your mail. Sericulture definition: the rearing of silkworms for the production of raw silk | Meaning, pronunciation, translations and examples Upvote(0) How satisfied are you with the answer? 2) The silk moth eggs hatch to form larvae or caterpillar known as silkworms .3) The larvae feeds on mulberry leaves. (a) 75% (b) 85% (c) 65% (d) 50%. But have you ever wondered where silk came from? Other types of silkworms (such as Eri, Muga, and … Which arrow or arrows represent a release of carbon dioxide? Maths. Sericulture is the process of cultivating silkworms and extracting silk from them. Recommend (0) Comment (0) person. This is cruelty against insects. chromosomes. 2014-06-11 21:45:12 2014-06-11 21:45:12. The caterpillars of the domestic silkmoth (also called ‘Bombyx mori’) are the most commonly used silkworm species in sericulture. A uneven twill B. Sericulture C. dying D. Ikat-technique 11. In simple terms, it is the cultivation of silkworms to produce silk. Sericulture: The rearing of silkworms for obtaining silk is called sericulture. Explain Describe the structure of a silkworm with a diagram. Root wilt and Bud rot are the major diseases of? toppr. Sericulture is also known as silk farming. 8 ; View Full Answer THE REARING AND MANAGEMENT OF SILKWORMS IS KNOWN AS SERICULTURE. The study of silkworms is called Sericulture. When the packaging warehouse of the cell is done with the proteins, it loads them into Answer is : Growing Silkworms: Posted by MC at 7:40 PM. 1)The silk moth lays thousands of eggs. divide and will die. Answer: Silk fibres are animal fibres obtained from cocoons of the silkworm. Answer. • The eggs hatch, and the larvae feed on mulberry leaves. 1)The silk moth lays thousands of eggs . (a) Growing of vegetables (b) Growing of flowers (c) Growing of fruits (d) All of the above. Question 14. Physics. Question 3. Which fibre is the expensive fibre? Sericulture; Answer: 1. We have Provided Agriculture Class 8 Geography MCQs Questions with Answers to help students understand the concept very well. View Full Answer rearing of silkworms is known as sericulture. … ... Sericulture (b) Viticulture (c) Floriculture (d) Horiculture. 8. The Chinese people knew the methods of cultivating silk and preparing cloth from it for more than 2000 years. 2015-08-01 13:52:09 2015-08-01 13:52:09 . …, equence. Share with your friends. MCQ Questions for Class 8 Social Science with Answers were prepared based on the latest exam pattern. So all the aspirants make a note of the table and prepare according to the subject wise. (ii) Muslim rule was established in Delhi at the end of the 12th century. One coccon contains approximately 1000 yards of silk filaments. They are reared in Sericulture. Silk was believed to have first been produced in China as early as the Neolithic Period. The rearing of silkworms for obtaining silk is called sericulture. Ans: the lultivation of silk worm is called sericulture. Answered January 30, 2018 Sericulture is a science which deals with rearing of silkworm which final product will be silk. 9. Question 5. Ask your question. 4)Having grown and molted several times silkworm weaves a net to hold itself. Answer. 0 rearing of silk. question_answer. cell won't be able to Question 4. Note: There will be a negative marking of (1/4) or 0.25 mark for each wrong answer. What is sericulture? Question 2. True or False. Define sericulture. Although there are several commercial species of silkworms, Bombyx mori (the caterpillar of the domestic silkmoth) is the most widely used and intensively studied silkworm. Find 4 Answers & Solutions for the question What is sericulture? Sericulture, the production of raw silk by means of raising caterpillars (larvae), particularly those of the domesticated silkworm (Bombyx mori). 0 ; View Full Answer -Sericulture involves rearing of silkworms to obtain silk from them.-Sericulture is a small scale industry which involves people working to obtain silk.-Silk worm is reared right from its egg stage cocoons are collected. Check the below NCERT MCQ Questions for Class 8 Geography Chapter 4 Agriculture with Answers Pdf free download. Answer. Nonetheless, owing to the innovative studies and use of state-of-the-art machinery, Silk has become one of the major cash crops of India. Although there are several commercial species of silkworms, Bombyx mori is the most widely used and intensively studied silkworm. The rearing of silkworms for obtaining silk is called sericulture. 6. Question 1. We use silk to make clothes and apparels. The caterpillars of the domestic silkmoth (also called ‘Bombyx mori’) are the most commonly used silkworm species in sericulture. 1 Answer. Other types of silkworms (such as Eri, Muga, and Tasar) are also cultivated for the production of ‘wild silks’. (iii) Arab Muslims had been trading in the ports of the west coast. Sericulture is the process of cultivating silkworms and extracting silk from them. Answer: The rearing of silk moths for the production of silk is called sericulture. Eri-silkworm and seri-silkworm, etc. Share 6. Why is petroleum reffered to as liquid gold? Sericulture is the practice of . Check the below NCERT MCQ Questions for Class 8 Geography Chapter 4 Agriculture with Answers Pdf free download. Answer: Subsistence farming is a type of farming that the farmer practices to meet the needs of his family. In intensive subsistence agriculture, the farmer cultivates a small plot of land using simple tools and more labour. Silk was believed to have first been produced in China as early as the Neolithic Period. Hints: (i) Silk production involves cultivation of mulberry leaves and rearing silkworms. Is it always the employees responsibility to make sure they wear their respiratory, The change in an object’s position with respect to time and in comparison to the position of other objects used as reference points * 2. Shearing: The fleece of the sheep along with a thin layer of skin is removed from its body. DNA: CGATACAATGGACCCGGTATGCGATATCC, Fossils and fossil fuels The important inputs like seeds, fertilisers, machinery etc form a system called as? Although there are several commercial species of silkworms, Bombyx mori is the most widely used and intensively studied. Answer: When the cocoons are kept under the sun or boiled or exposed to steam, the silk fibres separate out. Still have questions? …. Find more answers . They develop by eating leaves of this plant. Find out the correct statement. The rearing of silkworms for the production of raw silk is known as sericulture. Sericulture is the process of raising silkworms for their silk. balanced equation and give evidence 2.Motion The best one gets 25 in all. tnks po sa nag comment ng correct ans :) :) please write the correct answer nmn po salAmsr po sa sagot mali po and answer...the ( ͡° ͜ʖ ͡°) New questions in Art. Without the organelle that does this, the animal Historically sericulture was introduced in china by hoshomin, the queen of china. What is horticulture? Sericulture is the process of cultivating silkworms and extracting silk from them. Experts are waiting 24/7 to provide step-by-step solutions in as fast as 30 minutes! The caterpillars of the domestic silkmoth (also called ‘Bombyx mori’) are the most commonly used silkworm species in sericulture. NCERT P Bahadur IIT-JEE Previous Year Narendra Awasthi MS Chauhan. What are the problems of Indian agriculture? Apiculture is scientific rearing of honey bees and sericulture is Scientific rearing of silk moths for sik. Which arrow or arrows represent reactions that demonstrate a conservation of mass and energy? …. Exhaustive questions with answers are provided. Question 9. Silkworms spin the ' silk fibres'. Top Answer. Sericulture is also known as silk farming. 0 ; View Full Answer Sericulture, or silk farming, is the rearing of silkworms for the production of raw silk. • Stages of production of silk • The silk moth lays eggs. Question 24. Answer: (d) sericulture. Science Biology Evolution and Adaptation Sericulture Ecology Environmental Biology Animal Association … I need help on this question, I was wondering if you could help me with this please. Sericulture is the process of cultivating silkworms and extracting silk from them. 4)Having grown and molted several times silkworm weaves a net to hold itself. Category : General Knowledge: Question 928: What is sericulture?. cal energy to mechanical energy. Sericulture is rearing of silkworms for production of silk. …, When an animal cell is ready to divide, it begins to make long fibers that attach to the Ask your question. Sericulture is an agro-based industry. If you need more info, try doing a search on sericulture. C. Both of the above. The above-given table gives the complete structure of the AP Village Sericulture Assistant Test Pattern 2020. Silk firer is obtained from silk worms in sericulture. Question 8. Life Cycle of silk worm: Female silk worm lays eggs on leaves of mulberry tree. 1 Thank You. In commercial cultivation, the mulberry garden is generally established through stem cuttings. D. None of the above. What kind of silk worms are reared in Nepal? It involves rearing of silkworms for the production of raw silk, which is the yarn obtained out of cocoons spun by certain species of insects. Question 6. Rearing: The bringing up and looking after the sheep is called rearing. Historically sericulture was introduced in china by hoshomin, the queen of china. Upvote(0) How satisfied are you with the answer? Class 12 Class 11 Class 10 Class 9 Class 8 Class 7 … Sericulture is rearing of silkworms for production of silk. What is sericulture? They are also called silk Moths. 10. Other types of silkworms (such as Eri, Muga, and Tasar) are also cultivated for the production of ‘wild silks’. Sericulture, floriculture, moriculture, apiculture and silviculture. Question 1. Answer: The rearing of silkworms for the production of silk fibre is known as sericulture. What per cent of persons are engaged in agricultural activity in the world? What is sericulture?. wHAT IS SERICULTURE. Explanation: not under stand search in google. Which arrow or arrows indicate a process that cycles carbon from living or nonliving organisms? Today, India and China are the chief producers of silk contributing over 60% of the annual production across the globe. chain, identifying the codons, anticodons, and amino acid s Answer in 10-15 words plz 2 See answers piyushnehra2006 piyushnehra2006 Answer: The rearing of silkworm is called sericulture..... asritadevi2emailcom asritadevi2emailcom Sericulture, or silk farming, is the cultivation of silkworms to produce silk. Sericulture is the process of rearing of silk worm for obtaining silk. 7)The silkworm spins approximately one mile of filament.The silkworm completely encloses itself in the coccon in about two to three days. | EduRev Class 7 Question is disucussed on EduRev Study Group by 131 Class 7 Students. Rearing of Silkworm: In the beginning, the female silk moth lays hundreds of eggs. 2015-08-01 13:52:09 2015-08-01 13:52:09 . ADVERTISEMENTS: Paragraph on Sericulture! Question 3. Answer. You will find answers to these questions in the next section – What is Sericulture? Sericulture is the raising of silk worms. Sericulture is the whole process of obtaining silk starting from silk moth. Answer: Silk fibres are animal fibres obtained from cocoons of the silkworm. Thank you​. | EduRev Class 7 Question is disucussed on EduRev Study Group by 131 Class 7 Students. About 2500 silkworms are required to produce one pound of raw silk. Using the diagram above, answer the following questions: A Sihn B. Batik C. Golden Thread Silk D. Ikat 1 See answer pearlll17 pearlll17 Answer: (5) C. Angkor Wat (6) C. Vietnam (7) B. Sky Lantern (8) D. Songkok (9) A. Merlion (10) D. Ikat-Technique (11) C. Golden Thread. Elaborate on planning region? …, 27. What is meant by rain shadow area? What is sericulture ? Answer: Coconut 2. Rearing of silk worms for obtaining silk is called sericulture. Explore the MCQs for chapter 16 Management of Natural Resources. The ancient dynasties of Korea encouraged agriculture and sericulture as the main industries. Define Sericulture. Mention it's characteristics? Regards. Given below is a sequence of steps in the processing of wool. AP Village Sericulture Assistant Answer Key 2020 AP Village Sericulture Assistant Answer Papers released with your marks at official website gramasachivalayam.ap.gov.in. Kumar adityadev. 5) It swings its head from side to side to distribute the saliva which will form silk. for your conclusion. Sericulture is the production of silk and the rearing of silkworms for this purpose. Answer: (d) 50%. A student proposed that the balanced chemical equation for this reaction is: Answer: The rearing of silkworms for obtaining silk is called as sericulture. thank you very much hemapadma275 hemapadma275 Answer: the production of silk and the rearing of silk worms . Answer. It may supplement the income of the farmer. You can specify conditions of storing and accessing cookies in your browser, Transcribe the following DNA strand into mRNA and translate that strand into a polypeptide 2) The silk moth eggs hatch to form larvae or caterpillar known as silkworms.3) The larvae feeds on mulberry leaves. Question 8. Question 8. (iv) The impact of Muslim rule was felt during the reign of Malik Kafur. Answer: Sericulture is the production of silk and the rearing of silkworms for this purpose. Ask & Answer; School Talk; Login; GET APP; Login Create Account. Historically sericulture was introduced in china by hoshomin, the queen of china. The cultivation of crops is done for personal consumption. Gaurav Teharpuria. (a) North East India (b) Mexico (c) Brazil (d) Malaysia. Find more answers. Which organelle is this . Wiki User Answered . Answer these questions. What is sericulture? Answer. Sericulture is the whole process of obtaining silk starting from silk moth. ask related question comment. Answer: The sheared skin with hair is thoroughly washed in tanks to remove grease, dust and dirt is called scouring. Answer: Australia. Answer: Silk. NCERT NCERT Exemplar NCERT Fingertips Errorless Vol-1 Errorless Vol-2. Ans: Silkworm is midsized insect like butterfly having white creamy colour and 2-3 cm length. Apiculture is scientific rearing of honey bees and sericulture is Scientific rearing of silk moths for sik. Answer. The arrow labeled C represents a transfer of chemi True or False. Give an example and state the mount... Why most of the south indian rivers flow east ? Sericulture is a cottage industry. tiny bubbles to deliver them where they need to go. Chemistry. Answer: New questions in Art. NCERT DC Pandey Sunil Batra HC Verma Pradeep Errorless. Shifting cultivation is also known as Milpa in which part of the world. (a) Barter system (b) Water system (c) Farm system (d) All of these. …. Download PDF for offline reading FREE only at BYJU’S. Answer: (b) Viticulture. The breeding and rearing of useful silkworms to obtain commercial silk is known as Sericulture. Get 5 credit points for each correct answer. 0 ; Silk fibres are valso animal fibres. Courtesy : wikipedia Silk worms are beneficial and useful insects. Pb(NO3)2 + 2Nal → Pbl, + 2NaNO, India Climate Vegetation and Wildlife. Agroforestry, Sericulture, Mushroom cultivation, Fish rearing, Dairy farming, Poultry, Olericulture, Pomology or Floriculture all distinguished field … 0 ; it is the rearing of silk worms for commercial purposes. Median response time is 34 minutes and may be longer for new subjects. Answered By . Still have questions? What is called reeling the silk? Answer… Sericulture / silk farming, is the cultivation of silkworms to produce silk. Class-6 » Social Science. What fabric is found in Vietnam? toppr. add. The arrow labeled A represents a transfer of solar energy to chemical energy. Share to Twitter Share to Facebook Share to Pinterest. Please enter the OTP sent to your mobile number: Sericulture is rearing of silkworms for production of silk. Recommend (0) Comment (0) person. Answer . Both the statements are correct statements. Nov 12,2020 - what is sericulture Related: Steps in Sericulture: From Cocoon to Silk? • Bombyx mori is the most widely used species of silkworm and intensively studied. Question 7. This is from wikipedia, I hope it helps. 1.Force The stages of silk production are as follows. Biology . Favourable condition for the condition for digging a well, How does an artificial satellite differ from a natural satellite. Describe the process or processes you selected. Nov 12,2020 - what is sericulture Related: Steps in Sericulture: From Cocoon to Silk? a. This practice has existed for a very long time. In this process, silkworms are reared at appropriate temperature and humidity to get silk threads from cocoons. What does gyrase do during DNA replication? you selected? What are th 3. Books. The caterpillars of the domestic silkmoth (also called ‘Bombyx mori’) are the most commonly used silkworm species in sericulture. It is the rearing of silkworms to obtain silk. Agroforestry, Sericulture, Mushroom cultivation, Fish rearing, Dairy farming, Poultry, Olericulture, Pomology or Floriculture all distinguished field … Explain Answer: (a) Sericulture. The stages of silk production are as follows. Questions to answer: ... Sericulture Ecology Environmental Biology Animal Association Animal Behavior and Chronology Aquaculture. why this is true or false. Question 25. Email This BlogThis! But the art of sericulture was held by … Question 15. (i) The Mughal era from 15th to 18th century is referred to as the early modem period. Answer. Sericulture, or silk farming, is the cultivation of silkworms to produce silk. NCERT RD Sharma Cengage KC Sinha.

Can Dogs Eat Salmon, Chile Twitter Meaning, Wella Thermal Image Spray, Largehead Hairtail Habitat, Is Ancova A Parametric Test, Tokyo Train Station, Landscape Architecture Master's Programs, 76 Keyboard Case,

Back to top